Blast

Resultats:


BLASTN 1.4.7 [16-Oct-94] [Build 17:42:06 Mar 10 1995]

Reference:  Altschul, Stephen F., Warren Gish, Webb Miller, Eugene W. Myers,
and David J. Lipman (1990).  Basic local alignment search tool.  J. Mol. Biol.
215:403-10.

Notice:  this program and its default parameter settings are optimized to find
nearly identical sequences rapidly.  To identify weak similarities encoded in
nucleic acid, use BLASTX, TBLASTN or TBLASTX.

Query=  gb|X17217|ADAAVAR Avian adenovirus (CELO) DNA encoding VA
                  (virus-associated) RNA and six open reading frames.
        (4898 letters)

Database:  smallgenbank.fasta
           100 sequences; 205,192 total letters.
Searching.................................................done

                                                                     Smallest
                                                                       Sum
                                                              High  Probability
Sequences producing High-scoring Segment Pairs:              Score  P(N)      N

 gb AAUNKDNA 3576 Z17216   Avian adenovirus DNA (CEL06). ...   302  6.4e-17   1
 gb AAVSPHERE 8457 M77182   Amsacta entomopoxvirus sphero...   112  0.0052    4
 gb AAVSPHER 4657 M75889   Amsacta moorei entomopoxvirus ...    94  0.34      3
 gb AAFVMAF 3171 M26769   Avian musculoaponeurotic fibros...    92  0.96      2
 gb ACU10885 2773 U10885   AcMNPV HR3 p6.9 gene, partial ...   101  0.97      1
 gb ACSJUN 1074 M16266   Avian sarcoma virus 17 proviral ...    98  0.998     1
 gb AAVTHYKIN 1511 M80924   Amsacta entomopoxvirus thymid...    98  0.998     1
 gb AAPARV 4176 X74945   Aedes albopictus Parvovirus DNA....    92  0.998     2
 gb AD12PROT 809 X07655   Human adenovirus type 12 endopr...    97  0.9992    1
 gb ACU04879 3320 U04879   Autographa californica nuclear...    91  0.9994    2
 gb ACU09501 1572 U09501   Autographa californica nuclear...    96  0.9999    1
 gb A15H9HEX 1528 X76707   Adenovirus type 15H9 (Morrison...    88  0.99992   2


>gb AAUNKDNA 3576 Z17216   Avian adenovirus DNA (CEL06).             
  Length = 3576
  Minus Strand HSPs:
 Score = 302 (83.4 bits), Expect = 6.4e-17, P = 6.4e-17
 Identities = 62/64 (96%), Positives = 62/64 (96%), Strand = Minus / Plus
Query:    64 AGCGACACGCTGCGGTTATGGCCGGTTATGACTGCGTTAGTTTTTGAGGTTATTATACAT 5
             ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct:  3513 AGCGACACCGTGCGGTTATGGCCGGTTATGACTGCGTTAGTTTTTGAGGTTATTATACAT 3572
Query:     4 CATC 1             ||||Sbjct:  3573 CATC 3576

>gb AAVSPHERE 8457 M77182   Amsacta entomopoxvirus spheroidin gene, co
  Length = 8457  Minus Strand HSPs:
 Score = 112 (30.9 bits), Expect = 0.0052, Sum P(4) = 0.0052
 Identities = 48/80 (60%), Positives = 48/80 (60%), Strand = Minus / Plus
Query:  1507 TCAAAGTGATTGTTCAAGGTATGTCATTATATACATATTTACAATATGCATTAATATCAC 1448
             | ||| | || |   ||  ||  |  ||| || || ||||| | | |   || | || | 
Sbjct:   307 TAAAACTCATAGAATAATATAATTTTTTAAATTCAAATTTAGATTTTATGTTGAAATAAA 366
Query:  1447 CTATCTAATAGAGCATTAAT 1428             |||| ||||| |  | || |
Sbjct:   367 CTATATAATATAAAAATATT 386
 Score = 98 (27.1 bits), Expect = 0.0052, Sum P(4) = 0.0052
 Identities = 58/106 (54%), Positives = 58/106 (54%), Strand = Minus / Plus
Query:   175 AGATTCGTATTCGTATTGGTTAGAAAACAAATAAATCAATAAACTAATTTATGATATCAT 116
             | |||  | |||  || | ||  ||| ||  ||| ||| |    ||||      | ||  
Sbjct:  7317 ATATTAATCTTCTCATAGTTTTTAAACCACCTAATTCAGTTTTATAATCATATTTTTCTG 7376
Query:   115 TCATATTTATGGGTGTGGTTTTATTATGCGTCATAAAACTATTTTG 70
              ||||||      | | | ||  | ||  | |||||   |||| ||
Sbjct:  7377 CCATATTATATAATTTAGATTGCTCATCTGACATAATTATATTATG 7422
 Score = 94 (26.0 bits), Expect = 0.46, Sum P(3) = 0.37
 Identities = 26/35 (74%), Positives = 26/35 (74%), Strand = Minus / Plus
Query:  4082 AAAAAAATAGAAAAATGAACTAACCGACAATAAGA 4048
             |||| ||||  ||||| | | || ||| |||| ||
Sbjct:  3104 AAAACAATAAGAAAATTATCAAATCGAAAATATGA 3138
 Score = 93 (25.7 bits), Expect = 0.011, Sum P(4) = 0.011
 Identities = 37/60 (61%), Positives = 37/60 (61%), Strand = Minus / Plus
Query:   156 TTAGAAAACAAATAAATCAATAAACTAATTTATGATATCATTCATATTTATGGGTGTGGT 97
             ||| ||   | | |||||| |||| | |||| | | |    |  |||  || | |||| |
Sbjct:  6120 TTACAAGTTATAAAAATCATTAAAATGATTTTTTAAAATGATATTATCGATAGTTGTGAT 6179

Parameters:  W=4  V=500  B=250  -ctxfactor=2.00  E=10
  Query                        -----  As Used  -----    -----  Computed  ----
  Strand MatID Matrix name     Lambda    K       H      Lambda    K       H
   +1      0   +5,-4           0.192   0.226   0.357    same    same    same
   -1      0   +5,-4           0.192   0.226   0.357    same    same    same
  Query  Strand MatID  Length  Eff.Length   E    S W   T  X     E2  S2
   +1      0     4898      4898      10. 92 4  21 73   0.021 84
   -1      0     4898      4898      10. 92 4  21 73   0.021 84Statistics:
  Query          Expected         Observed           HSPs       HSPs
  Strand MatID  High Score       High Score       Reportable  Reported
   +1      0    100 (27.6 bits)   98 (27.1 bits)        6          6
   -1      0    100 (27.6 bits)  302 (83.4 bits)       23         23
  Query         Neighborhd  Word      Excluded    Failed   Successful  Overlaps
  Strand MatID   Words      Hits        Hits    Extensions Extensions  Excluded
   +1      0      4895     3999877     1124998     2874845       34         0
   -1      0      4895     4163077     1183486     2979551       40         0
  Database:  smallgenbank.fasta    Release date:  unknown
    Posted date:  2:36 PM MET DST Oct 08, 1996
  # of letters in database:  205,192  # of sequences in database:  100
  # of database sequences satisfying E:  12  No. of states in DFA:  85 (6 KB)
  Total size of DFA:  84 KB (128 KB)
  Time to generate neighborhood:  0.06u 0.00s 0.06t  Real: 00:00:00
  Time to search database:  57.02u 0.05s 57.07t  Real: 00:00:58
  Total cpu time:  57.19u 0.39s 57.58t  Real: 00:00:58